Class 3, Exercise 1 - Prog. for Bioinformatics IIWelcome to Intro. to Prog. for 
Bioinformatics II
Class 3, Exercise 1

1. Write a Perl program called 'extract_matches' to do the following: 
     a. Read a file called 'strings_data' line by line 
     b. In each line, look for the presence of the pattern in the 
         following string and fetch the offsets where the pattern appears 
         in the string 
     c. Create a hash called 'match_offsets' where the key is colon separated 
         pattern and string and the value is colon separated offsets! 
     d. Print the key-value pairs of this hash into a file called 'matches'
  
2. In this exercise we will work with the concept of counting nucleotides. Write 
a Perl program called 'count_nucleotides' to count the nucleotides in a data 
file which looks like this: 
ACTGCCACCAGGTCCTCGCGGTAGTCA 
GACGGTCAGCCGCGTTTATCGTCCTGA 
CCTCCGCGTAGGACGTCGTTGTTCTAG 
Print the sequence in each line followed by the counts. Print the total number 
of nucleotides, in this fashion: 
Seq is: ACTGCCACCAGGTCCTCGCGGTAGTCA 
A:5 C:10 G:7 T:5 
… 
… 
Total Counts => A:12 C:26 G:23 T:20